We narrowed to 32,701 results for: grna
-
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 atgRNA pDY2250
Plasmid#219860Purposeattachment site pegRNA for human NOLC1DepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBE-dGFP-gRNA
Plasmid#226862PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEsDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3401 BtoApegRNA-sfGFP
Plasmid#226667PurposePiggyBac cargo vector encoding B to A pegRNA marked with sfGFPDepositorInsertBtoA pegRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA4
Plasmid#164934PurposeExpresses EGFP sgRNA4 in mammalian cellsDepositorInsertsgRNA4 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only