We narrowed to 28,330 results for: STI
-
Plasmid#223743PurposeExpression of recombinant protein for purificationDepositorInsertSrc Kinase (SRC Human)
TagsGST-TEVExpressionInsectMutationY530F constitutively active mutantAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUt-mPF-GFP
Plasmid#199222PurposeLPUtopia-7 matching RMCE donor plasmid with GFP Positive-Feedback circuit (mPF-GFP). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertrtTA-Advanced::P2A::EGFP
TagsEGFPExpressionMammalianPromotertight TRE promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRecLV105 MEF2C S222A
Plasmid#107239PurposeA lentiviral vector for expression in mammalian cells encoding MEF2C-S222A insertDepositorInsertMEF2C S222A
UseRetroviralExpressionMammalianAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-B103 (LM2963)
Plasmid#208960PurposeA variant CE1 construct with B103 DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-B103-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX311 HRAS
Plasmid#117749PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
BII-ChBtW-dnTCF4-ires-GFP
Plasmid#133378PurposePiggybac vector for constitutive expressionDepositorInsertdnTCF4 (TCF4 Human)
Tags2x FlagExpressionMammalianMutationdeltaN31PromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-BFPCDK6-W
Plasmid#208756PurposeLentiviral vector expressing BFP fused with CDK6 cDNADepositorInsertCDK6 (CDK6 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase-recruited click editor - pCMV-T7-PCV2-nCas9-CC(N6) (LM2705)
Plasmid#208962PurposePolymerase-recruited click editor comprised of PCV2 fused to nCas9 with a C-terminal N6 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-CC(N6)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVAX1-BMP2/7 -
Plasmid#137912PurposeConstitutive mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, divergent)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-T7Sequenase (JO584)
Plasmid#208955PurposeA variant CE1 construct with T7 Sequenase DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Sequenase-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
BE3-NLS-NLS-P2A-BLAST
Plasmid#135348PurposeExpression of BE3 (Base editor generation three) with dual C-terminal NLS in a single operon encoding P2A blasticidine resistanceDepositorInsertBE3-2XNLS
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-ePhi29(+exo)-CC(N5) (LM2982)
Plasmid#208972PurposeRecruited ePhi29(+exo) DNA polymerase with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertePhi29(+exo)-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(+exo)(M8R/V51A/M97T/G197D/E221K/Q497P/K512…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Gal4-VP16-HSF1 WT
Plasmid#71726Purposeplasmid expressing fusion construct of Gal4 BDB VP16 AD and HSF1 WT RDDepositorInsertGal4 DBD HSF1 VP16 AD (HSF1 Herpes Simplex Virus protein VP16, Human, Budding Yeast)
ExpressionMammalianAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPINF Ta-sro1 WWE-PARP
Plasmid#192550PurposeE. coli expression vector for Triticum aestivum sro1 WWE-PARP domains (amino acids 2-434)DepositorInsertSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
TagsHis6, 3C protease cleavage siteExpressionBacterial, Insect, and Mamm…PromoterT7 promoterAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP SRBC
Plasmid#68399PurposeExpression of fluorescently tagged SRBC in mammalian cellsDepositorAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7-5'UTR-PE7-3'UTR-polyA (CJT612)
Plasmid#248222PurposePE7 IVT vector for mRNA productionDepositorInsert5'UTR-PE7-3'UTR-polyA
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); PE2 M-MLV(D200N/L603W/T330P/T306K…PromoterT7Available SinceMay 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEG-MeCP2_R270X (pc4751)
Plasmid#248579PurposeMammalian expression plasmid of MeCP2-R294X (aa1- aa293)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEG-MeCP2_R294X (pc4753)
Plasmid#248580PurposeMammalian expression plasmid of MeCP2-R294X (aa1- aa293)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT2HE_BEPA_MYH3C2-C3
Plasmid#250496Purpose2.8 kb muscle enhancer derived from freshwater Bear Paw Lake, AK stickleback driving GFP expressionDepositorInsertBEPA_MYH3C2-C3_intergenic_region
UseGene expression and genomic integration in fishAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only