We narrowed to 28,330 results for: STI
-
Plasmid#182745PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform delta 13) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform delta 13 (ALOX5 Human)
UseCre/Lox and LentiviralExpressionMammalianMutationcodon optimized for expression in homo sapiensAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmClover3-hsLem2
Plasmid#179524PurposeExpress OsTIR1 and mClover3-mAID-hsLem2 in mammalian cells under the control of EF1a promoterDepositorAvailable SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN459
Plasmid#137875PurposePiggyBac vector for expression of 1x gRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2 M133, 138, 186ILeu
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
ExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
ExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-Stab-exin21-eeBxb1-Stab (CJT607)
Plasmid#248212PurposebpNLS-, stabilon-, and exin21-tagged eeBxb1 recombinase, expressed from a CMV promoter.DepositorInsertbpNLS-Stab-exin21-eeBxb1-Stab
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationeeBxb1(V74A, E229K, V375I)PromoterCMV and T7Available SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Bsd-CMV-MDM4
Plasmid#202669PurposeMDM4 overexpression vector with blasticidin resistanceDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pERM2-nhpSer
Plasmid#201922PurposeEnables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.DepositorInsertsSepRS(2)
Sep-tRNA v2.0
SerB
EF-Sep
TagsNoneExpressionBacterialMutationE412P, E414F, T417K, P495M, I496W, F529S and H67R…PromoterGlnS (constitutive), OXB20 (constitutive), lpp (c…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-M-MLV(WT) (DRR1012)
Plasmid#217799PurposeVariant CE1 construct with wild-type M-MLV revese transcriptase (RT), expressed from CMV or T7 promotersDepositorInsertPCV2-XTEN-nSpCas9-BPNLS-M-MLV-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNoROS-CAT
Plasmid#170152PurposeMammalian expression vector encoding a constitutive nucleolar targeted roGFP and a doxycycline inducible nucleolar targeted catalase. Used to study nucleolar oxidationDepositorInsertsUseGenome integration via sleeping beauty transposon…TagsFLAG tag and Nucleolar Localization Sequence (NoL…ExpressionMammalianPromoterRPBSA and TRE promoterAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-Stab-exin21-Bxb1(A315R)-Stab (CJT605)
Plasmid#248211PurposebpNLS-, stabilon-, and exin21-tagged Bxb1 (A315R) recombinase, expressed from a CMV promoter.DepositorInsertbpNLS-Stab-exin21-Bxb1(A315R)-Stab
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationBxb1(A315R)PromoterCMV and T7Available SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K27M)-3AID-HA-2A-mCherryBSD
Plasmid#225698PurposeLentiviral expression of AID degron tagged H3.3(K27M) and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationK27MPromoterpEF1AAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUSE2ss-CLIg-mK_M18
Plasmid#82358PurposeExpression plasmid coding for kappa light chain of mouse antibody specific to antigen B of the ABO blood group system, clone M18.DepositorInsertTagsnoneExpressionMammalianPromoterhEF1-HTLV promAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only