We narrowed to 37,344 results for: ato
-
Plasmid#174811PurposeBacterial expression of a hyperactive PARP1 CAT lacking the autoinhibitory HD subdomainDepositorInsertPARP1-CATdeltaHD (PARP1 Human)
Tags6xHisExpressionBacterialMutationResidues 678-787 replaced by eight-residue linker…Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-LCOR
Plasmid#97038PurposeExpresses LCOR in mammalian cellsDepositorInsertLigand Dependent Nuclear Receptor Corepressor (LCOR Human)
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CAT-L713F
Plasmid#173944PurposeBacterial expression of isolated PARP1 CAT domain containing L713F gain-of-function mutationDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-L713F
Plasmid#174794PurposeBacterial expression of a hyperactive PARP1 mutant (L713F destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-C125G
Plasmid#174792PurposeBacterial expression of a less active PARP1 mutant (C125G reduces affinity for single-strand DNA break)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mDrc7-FLAG
Plasmid#176470PurposeExpression vector of mouse dynein regulatory complex subunit 7 (Drc7) tagged with FLAG at C-terminus.DepositorInsertdynein regulatory complex subunit 7 (Drc7 Mouse)
TagsFLAGExpressionMammalianPromoterCAG promoterAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986H
Plasmid#174801PurposeBacterial expression of a PARP1 mutant that produces highly branched but short PAR chains overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986S
Plasmid#174802PurposeBacterial expression of a PARP1 mutant that produces mainly short PAR oligomersDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G972R
Plasmid#174800PurposeBacterial expression of a PARP1 mutant that produces less PAR oligomers overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
scAAV-TTR-mFgf15
Plasmid#190594PurposeAAV construct containing Fgf15 cds under control of TTR promoterDepositorAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A774L
Plasmid#174796PurposeBacterial expression of a hyperactive PARP1 mutant (A774L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-W318R
Plasmid#174793PurposeBacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only