We narrowed to 13,986 results for: crispr grnas
-
Plasmid#80940PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
Plasmid#114730PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M7
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-lvaA
Plasmid#106397PurposeGuide RNA plasmid targeting lvaA on BBR1-UP originDepositorInsertsgRNA towards lvaA in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA1
Plasmid#78585Purposedelete USP19 gene in human cellDepositorInsertUSP19 sgRNA1
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SaCas9_sgRNA2
Plasmid#107330PurposeU6 driven SaCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-cj-E sgRNA
Plasmid#169915PurposeExpression of sgRNA on an optimized gRNA scaffold contains A-U pair flip stabilize the CjCas9/sgRNA complex.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only