We narrowed to 47,254 results for: STI;
-
Plasmid#167186PurposeLentiviral expression of sgRNA with blasticidin and puromycin resistance genesDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS::PTPRFb-DN-GFP
Plasmid#37111DepositorInsertUAS::PTPRFb-DN-GFP (ptprfb Zebrafish)
UseTol2 gateway expression vectorTagsEGFPMutationDeleted aa1386-1909 corresponding to phosphatase …Promoter10xUASAvailable SinceJuly 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag 3B/WT myc-M87
Plasmid#87722PurposeExpresses WT myc-M87 spastin isoform in mammalian cellsDepositorInsertSPAST (SPAST Human)
TagsMycExpressionMammalianMutationM87 isoform (deletion of nt 1-490 - 5'UTR an…PromoterCMVAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
delta-EGFP
Plasmid#119223PurposeGABAA receptor expression (delta subunit with EGFP tag at the C-terminus)DepositorAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 340-595
Plasmid#11634DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal half of merlin isoform 1.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
FFiBlast MSCV Puro
Plasmid#68464PurposeRetroviral plasmid for establishment of blasticidin resistance Cre-reporter cell lineDepositorInsertBlasticidin Resistance
UseCre/Lox and RetroviralExpressionMammalianMutationInvertedPromoterLTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2-AA012
Plasmid#185751PurposeVector to introduce eGFP under control of pAaEF1a into the genome of the hornwort Anthoceros agrestis via Agrobacterium mediated transformation. eGFP contains a cell membrane localization tag.DepositorInsertsHygR2
eGFP
Tagsmembrane localization tag Lti6bExpressionPlantAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F1
Plasmid#184163PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 1, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-hygro-hPGAP3-3HA
Plasmid#50373PurposeExpress C-terminally triple HA tagged human PGAP3 in mammmalian cellsDepositorInsertPGAP3 post-GPI attachment to proteins 3 (PGAP3 Human)
Tags3x HAExpressionMammalianPromoterSR alphaAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVH028
Plasmid#80393PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains + salicylate inducible phosphatase (Psal-CusSmut)DepositorUseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsExpressionBacterialMutationGlycine 448 changed to Alanine, makes it primaril…Available SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 340-590
Plasmid#11633DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal half of merlin isoform 2.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 308-579
Plasmid#11632DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal common domain of merlin.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pWPXL-resNP1
Plasmid#65061PurposeConstitutive expression of NP1 resistant to silencing by RNAi with pLVTH-shNP1DepositorInsertNeuronal Pentraxin 1 (Nptx1 Rat)
UseLentiviralExpressionMammalianMutationG447A, C450T, A451T, G452C, C454A, C456A, C459GPromoterEF1alphaAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-null (BPK1077)
Plasmid#171128PurposePlasmid encoding a pCMV-T7 with a 2 amino acid peptide prior to a stop codon.DepositorInsertpCMV-T7 null expression plasmid that encodes a two amino acid peptide (Met-Asp)
UseCRISPRExpressionBacterial and MammalianPromoterpCMV and T7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-GgVCL/*TBM
Plasmid#162790PurposeMUTATED_transfection of mammalian cells with Vcl mutated in Tankyrase Binding Motif -II (TBM-II) under a β-actin promoter, with IRES-GFP allowing identification of transfected cellsDepositorArticleInsertMutated Gallus gallus vinculin (G454V) (VCL Chicken)
TagsIRES-GFPExpressionBacterial and MammalianMutationchanged Gly 454 to ValPromoterbeta actinAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA-DAB1
Plasmid#162691PurposeExpresses DabAB1 inorganic carbon transport complexDepositorInsertDabAB1 inorganic carbon transport complex
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only