We narrowed to 19,362 results for: gateway
-
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway CloningMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-psmg1
Plasmid#192723PurposeGateway entry vector encoding zebrafish psmg1DepositorInsertpsmg1 (psmg1 Zebrafish)
UseGateway CloningMutationR96Q (rs514814252); T152M (rs501951686); T189A (r…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-get1
Plasmid#192722PurposeGateway entry vector encoding zebrafish get1DepositorAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HMGN1-SE
Plasmid#192720PurposeGateway entry vector encoding mutant HMGN1DepositorAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-B3GALT5
Plasmid#192719PurposeGateway entry vector encoding human B3GALT5DepositorAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hmgn6
Plasmid#192715PurposeGateway entry vector encoding zebrafish hmgn6DepositorAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_fcpNAT_GWB
Plasmid#154032PurposeGateway cloning into T. pseudonana episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
R777-E350 Hs.TIAM2-nostop
Plasmid#70634PurposeGateway ORF clone of human TIAM2 [NM_001010927.2] without stop codon (for C-terminal fusions)DepositorInsertTIAM2 (TIAM2 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E326 Hs.SPRED3-nostop
Plasmid#70610PurposeGateway ORF clone of human SPRED3 [NM_001042522.2] without stop codon (for C-terminal fusions)DepositorInsertSPRED3 (SPRED3 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E336 Hs.STK11-nostop
Plasmid#70620PurposeGateway ORF clone of human STK11 [NM_000455.4] without stop codon (for C-terminal fusions)DepositorInsertSTK11 (STK11 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E337 Hs.STK3
Plasmid#70621PurposeGateway ORF clone of human STK3 [NM_006281.3] with stop codon (for native or N-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E339 Hs.STK4
Plasmid#70623PurposeGateway ORF clone of human STK4 [NM_006282.2] with stop codon (for native or N-terminal fusions)DepositorInsertSTK4 (STK4 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E344 Hs.TFDP1-nostop
Plasmid#70628PurposeGateway ORF clone of human TFDP1 [NM_007111.4] without stop codon (for C-terminal fusions)DepositorInsertTFDP1 (TFDP1 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E345 Hs.TFDP2
Plasmid#70629PurposeGateway ORF clone of human TFDP2 [NM_006286.4] with stop codon (for native or N-terminal fusions)DepositorInsertTFDP2 (TFDP2 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E346 Hs.TFDP2-nostop
Plasmid#70630PurposeGateway ORF clone of human TFDP2 [NM_006286.4] without stop codon (for C-terminal fusions)DepositorInsertTFDP2 (TFDP2 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E308 Hs.SHC1-nostop
Plasmid#70592PurposeGateway ORF clone of human SHC1 [NM_003029.4] without stop codon (for C-terminal fusions)DepositorInsertSHC1 (SHC1 Human)
UseGateway CloningAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by