We narrowed to 8,396 results for: aav
-
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1(guide_2)
Plasmid#205417PurposeMutagenesis of Ntsr1, second guideDepositorAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-9-SV40 polyA
Plasmid#190873PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode9
UseAAVMutationWTAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-P2A-puro
Plasmid#192131PurposeExpresses Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9
UseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-tC3-FLAG
Plasmid#129477PurposeAAV2 transfer plasmid for truncated C3 tagged with FLAG with EGFP under control of the CBA promoterDepositorInsertFLAG-tagged (C-terminus) truncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1473 - pAAV CaMKII KDELR2-Myc-DDK
Plasmid#192600PurposeAn AAV packaging vector that expresses KDELR2 under control of the CaMKII promoter.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA
Plasmid#194725Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA array targeting both AAVS1 and MAFBDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV CCR6-eLOV-TEVcs-Gal4
Plasmid#173113PurposeExpresses CCR6 receiver construct in mammalian cellsDepositorInsertCCR6-eLOV-TEVcs-tTA
UseAAVPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-7-SV40 polyA
Plasmid#190871PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode7
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-8-SV40 polyA
Plasmid#190872PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode8
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-6-SV40 polyA
Plasmid#190870PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode6
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGW02 AAV-TBG-Cre-sgP53-sgRNA
Plasmid#192162PurposeAAV-TBG-Cre-sgP53-sgRNADepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only