We narrowed to 14,450 results for: cas9 genes
-
Plasmid#103087PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB5JU35(Cas9 coding gene from gamma proteobacterium HTCC5015)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B5XLC1
Plasmid#103088PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB5XLC1(Cas9 coding gene from Streptococcus pyogenes serotype M49 (strain NZ131))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-C4ZA16
Plasmid#103090PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertC4ZA16(Cas9 coding gene from Eubacterium rectale (strain ATCC 33656 / VPI 0990))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGyA
Plasmid#160292PurposeDrives expression of Cas9 and a TdTomato fluorescent markerDepositorInsertsVas promoter
hSpCas9
tdTomato
CTCF insulator
Gypsy insulator
Left homology arm Y chromosome
Right homology arm Y chromosome
TagsT2A GFPExpressionInsectAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA Ser promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGES201
Plasmid#190197PurposeFor CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKMW281_dSpRY
Plasmid#244822PurposeMammalian expression of catalytically inactive SpRY Cas9 (dSpRY)DepositorInsertdSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterCAGAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS484_10xHis_MBP_TEV_dSpRY
Plasmid#244832PurposeBacterial expression of catalytically inactive SpRY Cas9 (dSpRY) for protein purificationDepositorInsertdSpRY Cas9
UseCRISPRTags10xHis-MBPExpressionBacterialMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pJCHph
Plasmid#185863PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a hygromycin B-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; HphMX6
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCKan
Plasmid#185862PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a G418-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; KanMX4
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG1
Plasmid#162602PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG3
Plasmid#162604PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only