We narrowed to 284,040 results for: addgene
-
-
-
-
-
-
-
-
-
-
-
-
-
TAL3184
Plasmid#41358DepositorInsertZebrafishCommunity-stac-Left (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
TAL3185
Plasmid#41359DepositorInsertZebrafishCommunity-stac-Right (LOC100005402 Zebrafish)
Uset7Tags3X Flag and WT FOKIExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CaMKIIa::iLMO2
Plasmid#129481PurposeAAV2 transfer plasmid for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemical, under control of the glutamatergic-selective CaMKIIa promoterDepositorInsertiLMO2
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19_HR-BirA-FLAG_Ago2
Plasmid#170918PurposeEncodes BirA-FLAG with left and right homology arms for endogenous tagging of Ago2DepositorInsertBirA-FLAG
ExpressionMammalianPromoterlacAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19_HR-BirA-FLAG_Ago1
Plasmid#170919PurposeEncodes BirA-FLAG with left and right homology arms for endogenous tagging of Ago1DepositorInsertBirA-FLAG
ExpressionMammalianPromoterlacAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only