We narrowed to 5,861 results for: 129
-
Plasmid#245652PurposeLevel 0 Golden Gate part ToxA promoter, GGAG - AATGDepositorInsertToxA promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12013
Plasmid#245630PurposeLevel 0 Golden Gate part 6GAL4UAS promoter, GGAG - AATGDepositorInsert6GAL4UAS promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
R777-E190 Hs.PREX2-nostop
Plasmid#70474PurposeGateway ORF clone of human PREX2 [NM_024870.2] without stop codon (for C-terminal fusions)DepositorInsertPREX2 (PREX2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL12050
Plasmid#245647PurposeLevel 0 Golden Gate part Barley Oleosin promoter, GGAG - AATGDepositorInsertBarley Oleosin promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12063
Plasmid#245649PurposeLevel 0 Golden Gate part Act2 +SSU301 Leader promoter, GGAG - AATGDepositorInsertAct2 +SSU301 Leader promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12055
Plasmid#245648PurposeLevel 0 Golden Gate part Suc2 promoter, GGAG - AATGDepositorInsertSuc2 promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12046
Plasmid#245643PurposeLevel 0 Golden Gate part SlUbi10 promoter, GGAG - AATGDepositorInsertSlUbi10 promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12014
Plasmid#245631PurposeLevel 0 Golden Gate part Act1 (OsAct) promoter, GGAG - AATGDepositorInsertAct1 (OsAct) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12015
Plasmid#245632PurposeLevel 0 Golden Gate part Ubiquitin10 (AtUbi10) promoter, GGAG - AATGDepositorInsertUbiquitin10 (AtUbi10) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12026
Plasmid#245633PurposeLevel 0 Golden Gate part Amil Chromoprotein promoter, GGAG - AATGDepositorInsertAmil Chromoprotein promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12027
Plasmid#245634PurposeLevel 0 Golden Gate part Lotus Ubiquitin promoter, GGAG - AATGDepositorInsertLotus Ubiquitin promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12039
Plasmid#245641PurposeLevel 0 Golden Gate part YAO promoter, GGAG - AATGDepositorInsertYAO promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12034
Plasmid#245639PurposeLevel 0 Golden Gate part TrpC promoter, GGAG - AATGDepositorInsertTrpC promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12038
Plasmid#245640PurposeLevel 0 Golden Gate part RPS5a promoter, GGAG - AATGDepositorInsertRPS5a promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12009A
Plasmid#245629PurposeLevel 0 Golden Gate part Ubiquitin (ZmUbi) promoter, GGAG - AATGDepositorInsertUbiquitin (ZmUbi) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12005
Plasmid#245627PurposeLevel 0 Golden Gate part lexA promoter, GGAG - AATGDepositorInsertlexA promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12040
Plasmid#245642PurposeLevel 0 Golden Gate part 35Sx2+OsMac3 5' UTR promoter, GGAG - AATGDepositorInsert35Sx2+OsMac3 5' UTR promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL12002
Plasmid#245626PurposeLevel 0 Golden Gate part pAt6: Ubiquitin / AtUbl5 (At5g42300) promoter, GGAG - AATGDepositorInsertpAt6: Ubiquitin / AtUbl5 (At5g42300) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12081
Plasmid#245651PurposeLevel 0 Golden Gate part pLAT52 Pollen Specific promoter, GGAG - AATGDepositorInsertpLAT52 Pollen Specific promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only