We narrowed to 4,733 results for: GCA
-
Plasmid#77402Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PFKM gRNA (BRDN0001149086)
Plasmid#77076Purpose3rd generation lentiviral gRNA plasmid targeting human PFKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTPCR gRNA (BRDN0001147571)
Plasmid#76875Purpose3rd generation lentiviral gRNA plasmid targeting human NTPCRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK1 gRNA (BRDN0001147719)
Plasmid#76808Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAF9 gRNA (BRDN0001146418)
Plasmid#76566Purpose3rd generation lentiviral gRNA plasmid targeting human TAF9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11A gRNA (BRDN0001145793)
Plasmid#75889Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11A gRNA (BRDN0001146824)
Plasmid#75890Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11A gRNA (BRDN0001147530)
Plasmid#75892Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutA
Plasmid#13498DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutB
Plasmid#13499DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-U6-gTnfrfs1a-CBh-mCherry-SV40late
Plasmid#249127Purposeexpression of gTnfrsf1a and mCherryDepositorAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 Hygro sgIKBKG_1
Plasmid#241449PurposeDelete IKBKGDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ITGB1-V1
Plasmid#215454PurposeExpression vector with integrin beta1 tagged with the BiFC V1 fragmentDepositorInsertITGB1 (ITGB1 Human)
TagsVenus fragment 1 (V1)ExpressionMammalianMutationSilent mutations added to disrupt shRNA binding a…PromoterCMVAvailable SinceNov. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced MUT
Plasmid#242750PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-ITGB1(no stop)
Plasmid#215453PurposeGateway entry vector with integrin beta1 wild-type (WT) without a stop codonDepositorInsertITGB1 (ITGB1 Human)
UseGateway CloningMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceSept. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_2b)-PGKpuro2ABFP-W
Plasmid#208419PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(WT)
Plasmid#215450PurposeGateway entry vector with integrin beta1 wild-type (WT)DepositorInsertITGB1 (ITGB1 Human)
UseGateway CloningMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only