We narrowed to 6,621 results for: mos
-
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1/Myc-His beta4
Plasmid#16039DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-NUDT5
Plasmid#219955PurposeFor protein purification from EcoliDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-FRT Kir2.1-2A-GFP
Plasmid#161577PurposeExpression of Kir2.1-2A-GFP in a Flp-dependent fashionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-P2A-iCre (JDW 921)
Plasmid#224519PurposeA Gateway compatible middle entry clone containing EGFP P2A iCre (codon optimized cre)DepositorInsertEGFP-P2A-iCre
UseCre/LoxAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHes1(467)-luc
Plasmid#41723DepositorInsertHes1 Promoter (-467 to +46) (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoter (-467 to +46)PromoterHes1 promoter fragment (-467 to +46)Available SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
phROSA26-Tet-HA-JSAP1_WT
Plasmid#208772PurposeTetracycline inducible expression vector for HA-JSAP1_WT, used as a donor plasmid for HA-JSAP1_WT knock-in at the human ROSA26 locusDepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-10nm-EBFP2
Plasmid#231184PurposeExpresses a synthetic linker, tagged with EBFP2, Stabilizing the ER-mitochondrial distance at 10 nmDepositorInsert10nm-EBFP2
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF2
Plasmid#84026PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 35-58; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF1
Plasmid#84025PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 13-34; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta GLEBS
Plasmid#84028PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 357−373; Q394RPromoterUCOE / SFFVAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CREB3L1
Plasmid#214767PurposeMammalian expression of human CREB3L1DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
IFNGR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176939PurposeMammalian expression vector encoding IFNGR2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-Lifeact-EGFP-3xHA (JDW 1322)
Plasmid#224494PurposeGateway compatible middle entry clone containing Lifeact-EGFP (EGFP F-actin reporter)DepositorInsertLiefact-EGFP-3xHA
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-LAP3
Plasmid#217660PurposeFor gateway cloning of LAP3DepositorInsertLAP3 (LAP3 Human)
Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 R211L mutant
Plasmid#161991PurposeExpresses two mutated tandem repeats of Tapp1 PH domain (phosphoinositide binding-deficient mutant of TAPP1, R211L, can't bind PI(3,4)P2). Fused to eGFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only