We narrowed to 5,443 results for: mag
-
Plasmid#67757PurposeExpresses N-terminal kinase domain of Chk1 with C-term GFP fluorescent tagDepositorInsertzebrafish Chk1
TagsGFPMutationonly encodes N-term kinase domain (amino acids 1-…Available sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-BioSrcFR
Plasmid#252353PurposePiggybac expression vector with BioSrcFR.DepositorInsertBioSrcFR
UseLentiviralPromoterCMVAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-miRFP670nano3
Plasmid#252338PurposeGateway shuttle vector with miRFP670nano3.DepositorInsertmiRFP670nano3
UseGateway shuttle vectorTagsFLAGPromoterNoneAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDM1514-Plin
Plasmid#252025PurposeDictyostelium discoideum, safe haven knock-in plasmid for the act5 locus, N-terminal mCherry taggingDepositorInsertplin
UseAmoebal expressionTagsmCherryAvailable sinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDM1513-Vps32
Plasmid#252024PurposeDictyostelium discoideum, safe haven knock-in plasmid for the act5 locus, N-terminal GFP tagging of the gene Vps32DepositorInsertVps32
UseAmoebal expressionTagsGFPAvailable sinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
knockin GAPDH-GvpNtoV
Plasmid#232726PurposeGvpN to GvpV genes knockin at the GAPDH locusDepositorInsertGvpN to GvpV
ExpressionMammalianAvailable sinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.500bp
Plasmid#245110PurposeInserts 500 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:500
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.400bp
Plasmid#245111PurposeInserts 400 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:400
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.300bp
Plasmid#245112PurposeInserts 300 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:300
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.200bp
Plasmid#245113PurposeInserts 200 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:200
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.100bp
Plasmid#245114PurposeInserts 100 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:100
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.100bp_offset
Plasmid#245115PurposeInserts 100 bp of VSG-228 coding sequence in T. brucei rDNA spacer overlapping AnTat1.1 position 694, centered around common VSG-228 insertionDepositorInsertVSG-228:100_offset
UseOtherAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CAPS1-mKate2
Plasmid#245360PurposeMammalian expression of C-terminal mKate2-tagged rat CAPS1 wild typeDepositorAvailable sinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB085
Plasmid#239637PurposePlant RNA Vision constructs with 164 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA09
gRNA10-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable sinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB084
Plasmid#239636PurposePlant RNA Vision constructs with 123 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA07
gRNA08-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable sinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB086
Plasmid#239638PurposePlant RNA Vision constructs with 325 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA11
gRNA12-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable sinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
rsZACRO/pcDNA3
Plasmid#236199PurposeMammalian expression of rsZACRO, a positively reversibly photoswitchable fluorescent proteinDepositorInsertrsZACRO
ExpressionMammalianAvailable sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmKate2Spc
Plasmid#206813PurposeTemplate for hlpA-mkate2 amplification associated with spectinomycin resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmKate2Mutation3insGAvailable sinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-MannII-N-10
Plasmid#231769PurposeVisualization of Golgi in mammalian cells using mGold2sDepositorAvailable sinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only