We narrowed to 6,403 results for: siae
-
Plasmid#221087PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 Aro3+
Plasmid#231884PurposeBacterial expression of N-terminally 6His tagged Gcn4 Aro3+DepositorInsertGcn4 Aro3+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationD103Y, N112T, L113Y, S117F, K140RPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 Aro2+
Plasmid#231883PurposeBacterial expression of N-terminally 6His tagged Gcn4 Aro2+DepositorInsertGcn4 Aro2+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationN116F, S117E, E119N, P129Q, T132YPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 WTSLFD
Plasmid#231881PurposeBacterial expression of N-terminally 6His tagged Gcn4 WTSLFDDepositorInsertGcn4 WTSLFD
Tags6xHis, TEV cleavage siteExpressionBacterialMutationF108W, E109T, Y110S, E111L, N112F, L113DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 F108A+
Plasmid#231875PurposeBacterial expression of N-terminally 6His tagged Gcn4 F108A+DepositorInsertGcn4 F108A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationF108A, T121L, A141PPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED W
Plasmid#231871PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED WDepositorInsertGcn4 ILVtoED W
Tags6xHis, TEV cleavage siteExpressionBacterialMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoAS
Plasmid#231859PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoASDepositorInsertGcn4 ILVtoAS
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED
Plasmid#231857PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoEDDepositorInsertGcn4 ILVtoED
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAM72
Plasmid#227622PurposepETDuet-1 Rpn8(1-179)-precission-Strep, H6-precission-Rpn11(2-239, G77P)DepositorTagsHis-PrescissionExpressionBacterialMutation1-179 and aa 2-239, G77PPromoterT7Available SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM315 pACYC-His6-Rpn10[ΔUIM]
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only