Skip to main content
Addgene
Showing: 1 - 20 of 39 results

  1. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ...the S. cerevisiae lineage (7). In our class research project, students transform S. cerevisiae met deletion...synthesis (5). The budding yeast, Saccharomyces. cerevisiae, makes a great reference organism for the project... is available (6). Methionine synthesis in S. cerevisiae (Figure 1) occurs through a well-characterized...the same function as their counterparts in S. cerevisiae. The two yeasts are thought to have diverged ...carrying MET/Met genes from either S. pombe or S. cerevisiae. Students then determine if expression of the...plasmids in either E. coli (ori and ampR) or S. cerevisiae (2µm ori and URA3). The presence of the URA3 ...transformed with the plasmids, because the S. cerevisiae deletion strains are ∆ura3 mutants and cannot...

  2. K. phaffii: Rising to the Occasion

    Type
    Blog Post
    ...and it grows fast to boot. The yeast strains S. cerevisiae and S. pombe have dominated the research scene...used yeast strains: S. pombe (fission) and S. cerevisiae (budding). Yeast make for an excellent model ...genetic manipulation The first eukaryote (S. cerevisiae) to have its genome fully sequenced There are...wondering if the “biotech yeast” is S. pombe or S. cerevisiae. Actually, it’s neither. The most commonly used...phaffii and other yeast strains.     S. cerevisiae S. pombe K. phaffii Growth properties... is only distantly related to S. pombe and S. cerevisiae; evolutionarily it evolved much slower and bears...evolutionary feature of K. phaffii, relative to S. cerevisiae, is that it predominantly uses non-homologous...

  3. Plasmids 101: Yeast Vectors

    Type
    Blog Post
    ...L-hisitidine no S. cerevisiae  no yes   URA3 pyrimidine (uracil) yes - Grow with 5-FOA. S. cerevisiae yes - This...of a nitrogen source. S. cerevisiae  no no   LEU2 L-leucine no S. cerevisiae yes - This can complement...pertains to ORIs in budding yeast, Saccharomyces cerevisiae; however, we’ve also noted some features required... TRP1 L-tryptophan yes - Grow with 5-FAA. S. cerevisiae no  no TRP1 alters some yeast phenotypes. This...hydrosulfide ions yes - Grow with methylmercury. S. cerevisiae  no no Can be used for color and growth selection...

  4. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ...integrate protein tags into the genomes of S. cerevisiae and S. pombe. The protocol is surprisingly simple...assessed many of these fluorescent tags in S. cerevisiae, looking at their performance in categories such...a complimentary set of plasmids for use in S. cerevisiae, with the additional benefit of multiple selection...

  5. Rewiring Metabolic Circuitry with CRISPR RNA Scaffolds [Video]

    Type
    Blog Post
    ...metabolites in Escherichia coli or Saccharomyces cerevisiae with few techniques that are easily transferrable...oft published metabolic engineering realm of S. cerevisiae and E. coli. The utility of simultaneous and... of this to control a metabolic network in S. cerevisiae by using three RNA programs to differentially...

  6. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ...the MoClo YTK Kit specifically designed for S. cerevisiae is at your service (Lee et al., 2015). This kit...2017). In addition to additional elements for S. cerevisiae chromosomal integration and gene expression, ...Extensive and Flexible Engineering of Saccharomyces Cerevisiae.” ACS Synthetic Biology, vol. 12, no. 11, American...

  8. Plasmids 101: Protein Expression

    Type
    Blog Post
    ... yeast can be used for protein expression, S. cerevisiae, is the most reliable and frequently used species... in genetics and biochemistry. When using S. cerevisiae, researchers often place recombinant proteins...

  9. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...hybrid systems were developed in Saccharomyces cerevisiae in 1989 and are still used extensively to screen...heterologous systems (e.g. mammalian proteins in S. cerevisiae). While this may be difficult to resolve for...

  11. Five Popular Model Organisms

    Type
    Blog Post
    ...(Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic organism...190-195. Liu, Wei, et al. "From Saccharomyces cerevisiae to human: The important gene co‑expression modules...

  12. Validated gRNA Sequences

    Type
    Collection
    ... cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae GTTGAAAGTATTAGTTAAAG...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes 23460208...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter S. ...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes...

  17. Plasmids 101: Cre-lox

    Type
    Blog Post
    ...recombination event in a single system. The Saccharomyces cerevisiae FLP-FRT recombination system is another site-...
Showing: 1 - 20 of 39 results