Skip to main content
Addgene
Showing: 1 - 10 of 10 results

  1. Validated gRNA Sequences

    Type
    Collection
    ... cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae GTTGAAAGTATTAGTTAAAG...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes 23460208...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter S. ...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes...

  2. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One. 2013 Jul 2;8(7):e67902. doi: 10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-70. doi: 10.1002/yea...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186...

  3. Microbiology Resources

    Type
    Collection
    ... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...

  4. Genetic Code Expansion

    Type
    Collection
    ...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212125...

  5. Synthetic Biology - Overview

    Type
    Collection
    ...Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors...

  6. CRISPR Plasmids - Yeast

    Type
    Collection
    ...49014 pRPR1_gRNA_ handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you have suggestions...

  9. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes 181005 161769 Inhibition...
Showing: 1 - 10 of 10 results