Skip to main content

We narrowed to 2 results for: siae

Showing: 1 - 2 of 2 results
  1. Modular Cloning Guide

    Type
    Guide
    ...assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast...MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX ...the GoldenBraid system, for integration in S. cerevisiae . Easy-MISE Toolkit Yeast Expression Paola Branduardi...improved heterologous protein production in S. cerevisiae . MoClo Baculo Toolkit Yeast Expression, Insect...expression vectors for expression in baculovirus or S. cerevisiae . Compatible with MoClo-YTK , Bac-to-Bac, and...
  2. Sequencing Primers

    Type
    Guide
    ...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter... Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...
Showing: 1 - 2 of 2 results