We narrowed to 8,895 results for: aav
-
Plasmid#170387PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn CCL20-pre-mGRASP
Plasmid#173117PurposeExpresses CCL20 sender construct in neuronsDepositorInsertCCL20-pre-mGRASP
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRAC_DARIC(2-3)_CD22-BBz_AAV6_Donor
Plasmid#211906PurposeVector for AAV6 donor production. Targeted CD22-BBz DARIC transgene integration to the TRAC locus via homology-directed repair.DepositorInsertDARIC-CD22-BBz
UseAAVExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClα.CreON
Plasmid#196995PurposeCre recombinase dependent expression of GluClv2.0 alpha subunit. GluClα contains a Cerulean tag. When co-expressed with GluClv2.0 beta subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClα -Cerulean
UseAAV and Cre/LoxTagsCeruleanPromotershort CAGAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniSOG
Plasmid#193913PurposeControl plasmid that expresses non-targeted miniSOG in mammalian cellsDepositorInsertminiSOG
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCaMKII-tTAc
Plasmid#172125PurposeExpression of InteinC-tTAC in CaMKII positive cellsDepositorInsertpCaMKII, tTAc
UseAAVPromoterCaMKIIAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV asRILpolyGly GFP (OPDM type 4)
Plasmid#250411PurposeGFP-tagged polyglycine protein expressed from the antisense transcript of RILPL1. This vectors uses 100 GGN optimized codons.DepositorInsertasRILpolyGly
UseAAVTagsGFPExpressionMammalianAvailable SinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-hSyn-PiGM-Iq(D387A mCherry)
Plasmid#221605PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and mCherry as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, mCherry)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_VIP1.0
Plasmid#208680PurposeExpresses the genetically-encoded fluorescent vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0 in a cre-dependent mannerDepositorInsertGPCR activation based vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D377Y-mPCSK9 (AAV8)
Viral Prep#58376-AAV8PurposeReady-to-use AAV8 particles produced from pAAV/D377Y-mPCSK9 (#58376). In addition to the viral particles, you will also receive purified pAAV/D377Y-mPCSK9 plasmid DNA. hAAT-driven expression of mutant (D377Y) murine PCSK9. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHCRApoE/hAATAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-double floxed-eNpHR-EYFP-WPRE-pA (AAV9)
Viral Prep#20949-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-double floxed-eNpHR-EYFP-WPRE-pA (#20949). In addition to the viral particles, you will also receive purified pAAV-double floxed-eNpHR-EYFP-WPRE-pA plasmid DNA. EF1a-driven, cre-dependent eNpHR EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1b.WPRE.SV40 (AAV1)
Viral Prep#100857-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.NES-jRGECO1b.WPRE.SV40 (#100857). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1b.WPRE.SV40 plasmid DNA. Syn-driven jRGECO1b calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry
Plasmid#176277PurposeViral vector for co-expression of a CDS of interest and mCherry in cells expressing Flp AND NOT Cre driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-mCherry
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV C-terminus ABE8e-V106W targeting Pex1-G844D
Plasmid#247655PurposeAAV genome encoding the C-terminus of ABE8e-V106W editor and Sp sgRNA cassetteDepositorInsertC-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
UseAAV and CRISPRPromoterCBhAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV N-terminus ABE8e-V106W targeting Pex1-G844D
Plasmid#247654PurposeAAV genome encoding the N-terminus of ABE8e-V106W editor and Sp sgRNA cassetteDepositorInsertN-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
UseAAV and CRISPRPromoterCBhAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorInsertNES-SomaKGECO1
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only