We narrowed to 7,048 results for: plasmid dna
-
Plasmid#99913PurposeReceptor plasmid for the assembly of multiple sgRNAsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only
-
BSP602
Plasmid#122249Purposeexpression vector for mScarlet under EFT3 PromoterDepositorInsertmScarlet
UseSynthetic BiologyExpressionWormPromoterEFT3Available SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDHJS3 AN-
Plasmid#78241PurposeOne of four plasmids needed to create the mismatched double Holliday junction substrate (MM-DHJS).DepositorInsertsloxP
sequence "A" with NheI site
loxP2
Available SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDHJS3 AS-
Plasmid#78237PurposeOne of four plasmids needed to create the double Holliday junction substrate (DHJS).DepositorInsertsloxP
sequence "B"
loxP2
UsePhagemidAvailable SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only