We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#166072PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA targeting intergenic site near HXT6 (within YDR344C) for double stranded break formation in yeast.DepositorInsertIntergenic site near HXT6 (in YDR344C, possible dubious ORF)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
-
pQCi
Plasmid#154345PurposeSelf-Cutting and Integrating CRISPR backbone (px458 derivative with Cas9-intron, sgRNA, and bait integration sites)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only