We narrowed to 8,682 results for: aav
-
Plasmid#214568PurposeAiE2464m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1878 - pAAV-AiE2425m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214566PurposeAiE2425m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1690 - pAAV-AiE2365m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214517PurposeAiE2365m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1844 - pAAV-AiE2474m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214549PurposeAiE2474m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214598PurposeAiE2585m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1895 - pAAV-AiE2583m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214574PurposeAiE2583m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1897 - pAAV-AiE2486m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214575PurposeAiE2486m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1916 - pAAV-AiE2437m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214577PurposeAiE2437m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1920 - pAAV-AiE2375m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214580PurposeAiE2375m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1923 - pAAV-AiE2455m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214582PurposeAiE2455m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1933 - pAAV-AiE2446m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214585PurposeAiE2446m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1939 - pAAV-AiE2522m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214586PurposeAiE2522m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1941 - pAAV-AiE2525m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214587PurposeAiE2525m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1956 - pAAV-AiE2550m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214589PurposeAiE2550m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1959 - pAAV-AiE2588m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214590PurposeAiE2588m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1963 - pAAV-AiE2592m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214593PurposeAiE2592m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1965 - pAAV-AiE2475m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214595PurposeAiE2475m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1847 - pAAV-AiE2399m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214551PurposeAiE2399m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1851 - pAAV-AiE2530m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214554PurposeAiE2530m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only