We narrowed to 6,509 results for: nls
-
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only
-
LLP789_αGCN4-DNMT3A-CO
Plasmid#211783PurposeSunTag counterpart binding domain, aGCN4, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-puro
Plasmid#167830PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorInserthMbCpf1(dead2)
Tags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX391 Sphaerochaeta globus str. Buddy Cas9
Plasmid#68328PurposeSphaerochaeta globus str. Buddy Cas9DepositorInsertSgCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN41
Plasmid#61344PurposemCherry fused to LINuS, a light-inducible nuclear localization signal (biNLS9/PKIt NES)DepositorInsertmCherry
TagsGS linker-AsLov2-biNLS9 and PKIt NESExpressionMammalianPromoterCMVAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRG711_lexO-AscI_LexA-TF_HIS3MX
Plasmid#154820PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3320
Plasmid#107529PurposeExpresses human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInserthLbCpf1(RVR)
Tags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1136
Plasmid#29056PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP779_αGCN4-VP64-CO
Plasmid#211772PurposeSunTag counterpart binding domain, αGCN4, fused to transcriptional activator VP64, with GFP selectionDepositorInsertaGCN4-VP64
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect VP64 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP786_SpyCatcher-EZH2-FL-CO
Plasmid#211779PurposeSpyTag counterpart binding domain, SpyCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-KRAB
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP787_SnoopCatcher-EZH2-FL-CO
Plasmid#211780PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP780_SpyCatcher-KRAB-CO
Plasmid#211773PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-KRAB
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP784_SnoopCatcher-DNMT3A-CO
Plasmid#211777PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertSpy-EZH2
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only