We narrowed to 25,462 results for: CHI;
-
Plasmid#248154PurposeLentiviral vector encoding a truncated form of human FCRL3, containing only the first 93 residues of the cytoplasmic tail.DepositorInsertFCRL3 (FCRL3 Human)
UseLentiviralMutationMutagenesis to insert a stop codon at aa688 in FC…PromoterEF1_Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-H4-BioID2-HA
Plasmid#232026Purposemammalian expression (CMV promoter) of histone H4 fused to BioID2-HADepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTDGa-BioID2-HA
Plasmid#232027Purposemammalian expression (CMV promoter) of murine TDG fused to BioID2-HADepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-7zf(+)_mmSRA1
Plasmid#232032Purposein vitro transcription of murine Sra1DepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-3zf(+)_hsSRA1
Plasmid#232033Purposein vitro transcription of human Sra1DepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR3c-N540K-V5
Plasmid#246390Purposefor PiggyBac mediated integration and stable expression of hFGFR3c-N540K protein, mutant variant causes Hypochondroplasia and Thanatophoric dysplasiaDepositorInserthuman FGFR3c-N540K (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationN540K substitutionPromotertruncated CMV promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5R DD-FAM98B[1-330]
Plasmid#211358PurposeTransient expression of DD-V5-FAM98B[1-330]DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA1
Plasmid#228755PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA2
Plasmid#228756PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP6
Plasmid#218245Purpose1) Ectopic expression of MAAP6 protein in mammalian cells. 2) Packaging MAAP6 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP9
Plasmid#218246Purpose1) Ectopic expression of MAAP9 protein in mammalian cells. 2) Packaging MAAP9 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-FOXA3
Plasmid#219395PurposeExpress FOXA3 in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A-E1021A
Plasmid#213417PurposeVinculin tension sensor (VcnTS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A).DepositorInsertVcnTS-E1015A-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A-E1021A
Plasmid#213414PurposeVinculin conformation sensor (VcnCS) with both directionally asymmetric, force strengthening (DAFS) variant point mutations (E1015A and E1021A).DepositorInsertVcnCS-E1015A-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 and 1021 to a…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1mORF1-ΔORF2-scFvFc
Plasmid#206023PurposeThe base next to the ORF1 start codon (ATG) was deleted in pLINE1ΔORF2-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, encoding mutated ORF1 but lacking ORF2
ExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
CSII-TK-B4GALT3
Plasmid#203598PurposeLentiviral vector to express B4GALT3 in mammalian cellsDepositorInsertbeta-1,4-galactosyltransferase 3 (B4GALT3 Human)
UseLentiviralExpressionMammalianMutationWTPromoterTKAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
CSII-TK-MAIP1
Plasmid#203599PurposeLentiviral vector to express MAIP1 in mammalian cellsDepositorInsertmatrix AAA peptidase interacting protein 1 (MAIP1 Human)
UseLentiviralExpressionMammalianMutationWTPromoterTKAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-B4GALT3
Plasmid#203601PurposeReporter plasmid carrying B4GALT3 3'UTRDepositorInsertbeta-1,4-galactosyltransferase 3 (B4GALT3 Human)
UseLuciferaseExpressionMammalianMutationnt 1800-2330 3'UTRPromoterSV40Available SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only