We narrowed to 19,418 results for: IRE;
-
Plasmid#176651PurposeIt encodes an mVenus fused to a mutant p27K-, which lacks binding affinity to Cdk. This reporter helps to identify quiescent disseminated tumor cells (in G0 phase of cell cycle).DepositorInsertmVenus-p27K- (Cdkn1b Mouse)
UseLentiviralTagsmVenusMutationMutant K- (lacks affinity to Cdk)Available SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Isl1_2A_Lhx3-BSD
Plasmid#226282PurposeTetracycline-inducible expression of Isl1 and Lhx3 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsIsl1 and Lhx3 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Ngn2_2A_Sox11-PURO
Plasmid#226284PurposeTetracycline-inducible expression of Ngn2 and Sox11 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsNGN2 and SOX11 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-mSNCA-NE
Plasmid#102364PurposeLentiviral overexpression of PA-mCherry synuclein alpha fusionDepositorInsertsUseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.1248
Plasmid#19761DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA M. mulatta (rhesus macaque), Mouse, Human)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.2279
Plasmid#19762DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
NGFR P210
Plasmid#27486DepositorUseRetroviralTagsIRES and NFGRExpressionMammalianMutationContains the "complete" bcr/abl fusionAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc
Plasmid#154266PurposeFirefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
ExpressionMammalianPromoterHuman IGF-1 P1 PromoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Human, Synthetic)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
NGFR 210Y177
Plasmid#27487DepositorUseRetroviralTagsIRES and NGFRExpressionMammalianMutationTyrosine 177 mutated to Phenylalanine (Y177F)Available SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc
Plasmid#154267PurposeFirefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only