We narrowed to 6,460 results for: PROC
-
Plasmid#104780PurposepSC218UG-At Ubiquitin10:Gateway expression cassette binary vectorDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
RMCE K>R DNA-PKcs
Plasmid#233917PurposeLow copy number provides expression of human DNA-PKcs with a single K>R substitution that ablates kinase activity.DepositorInserthuman DNA-PKcs kinase inactive mutant K3753>R (PRKDC Human)
ExpressionMammalianMutationK3753RAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsAP, Avitag and HAExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBI-CMV1-mir451-CMV2-mir1
Plasmid#164635PurposeExpress miR-451 and miR-1-1 in mammalian cellsDepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-GCaMP6f-AAV
Plasmid#182501PurposeGFAP-ER-GCaMP6f AAV: An AAV5 constructed for ER-GCaMP6f with astrocyte specific GFAP promotorDepositorInsertER localized P450
UseAAVAvailable SinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ACME
Plasmid#186717PurposeACME dual-deaminase CRISPR base editorDepositorInsertACME
UseCRISPRTagsNucleoplasmin NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4 RT-G
Plasmid#19184DepositorInsertrpsL tetA
UseRecombineeringTags50 nucleotides of FLAG-GFPAvailable SinceJan. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSM_ser-2prom3p::myr-mCherry
Plasmid#164223PurposeExpression of membrane-localized mCherry driven by the ser-2promo3 promoter. For use as a PVD neuron marker in C. elegans.DepositorInsertmyr-mCherry
ExpressionWormPromoterser-2promo3Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p18S.2 tag
Plasmid#51731Purposetranscribes truncated transcript containing 18S and hybridization tagDepositorInsert18S
Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT85_P438-mEOS3.2_GentaR
Plasmid#173894PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the P438 promoterDepositorInsertmEos3.2
ExpressionBacterialPromoterP438Available SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti_DCLK1 G533N
Plasmid#163627PurposeExpresses DCLK1 G533N in E. coliDepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28Teb1
Plasmid#28173DepositorInsertTeb1
Tags6xhistidineExpressionBacterialAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
LT1_34_sfpHluorin
Plasmid#177707PurposePlasmid for genome integration in X2 site expressing sfpHluorin (intracellular pH biosensor)DepositorInsertpTEF1-sfpHluorin
UseUsed as donor in genome integration after lineari…ExpressionYeastAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Zika NS5 RdRp
Plasmid#204788PurposeBacterial expression of Zika NS5 RdRpDepositorInsertZika NS5 RdRp domain
ExpressionBacterialAvailable SinceApril 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOCC151
Plasmid#118899Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal GST, cleavable with 3CDepositorInsertNcoI-GST-3C-NotI-ccdB-AscI-stop-HindIII cassette
TagsGST tag, cleavable with 3C proteaseExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
ZE48 Dvl3 pCS2P+
Plasmid#17089DepositorInsertDvl-3 (dvl3a Zebrafish)
UseZebrafish expressionAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
LT2_7_OxPro
Plasmid#177709PurposePlasmid for genome integration in X2 site expressing OxPro (oxidative stress biosensor)DepositorInsertspTRX2_5xUAS-ymYPET-tCYC1
pTEFmut8-mCherry-tADH1
UseUsed as donor dna in genome integration after lin…ExpressionYeastAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-fDIO-mScarlet-KASH-2a-Cre
Plasmid#203838PurposeFlp-dependent Cre and mScarlet-KASH expressionDepositorInsertCre
UseAAVTagsmScarlet-KASH-2AAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOCC267
Plasmid#118887Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal HALO tagDepositorInsertNcoI-HIS6-MBP-3C-HALO-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; HALO tagExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only