We narrowed to 24,820 results for: CRISPR
-
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAC95-pmax-dCas9VP160-2A-neo
Plasmid#48227PurposedCas9VP160-2A-neo (neo/G418-selectable) on pmax expression vector. Note: This is being tested.DepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
UseCRISPRTags2A-neo, HA Tag, and VP160ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
NEK7 gRNA (BRDN0001162196)
Plasmid#77740Purpose3rd generation lentiviral gRNA plasmid targeting human NEK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_EF1a-CasRx-msfGFP-2A-Blast
Plasmid#226010PurposeCasRx protein for RNA targeting in piggyBac backboneDepositorInsertCasRx RNA-targeting nuclease
UseCRISPRTagsmsfGFPExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001145637)
Plasmid#77887Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162291)
Plasmid#77097Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162239)
Plasmid#77098Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMonAID_dCas9-PmCDA_Hyg_ALS
Plasmid#91692PurposeMonocot Target-AID vector expressing rice-optimized dCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A and H840A for dead Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
TK1 gRNA (BRDN0001145069)
Plasmid#76424Purpose3rd generation lentiviral gRNA plasmid targeting human TK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only