We narrowed to 10,693 results for: plasmids 101
-
Plasmid#184633PurposeExpresses Aldh1a1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
1000.pCCLsin.cPPT.hPGK.Myt1L.WPRE
Plasmid#67292PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
1000.pCCLsin.cPPT.hPGK.Myt1L.MIRT124_x4 Xma_lost.WPRE
Plasmid#67293PurposeInduce human iN conversion from fibroblastDepositorAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBstSK+IRES-V5-IPpoI (mutant)
Plasmid#206322PurposeA plasmid that facilitates production of mRNA encoding V5 epitope tagged catalytically dead I-PpoIDepositorInsertIRES element-V5 epitope tag-mutated IPpoI open reading frame
UseMrna productionTagsV5-IPpoI fusion protein (mutant version)Available SinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
AID-BFP-loxP_myo2_neoR
Plasmid#194054PurposeDual-selection cassette plasmid for knocking-in AID-BFP into the C. elegans genomeDepositorAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMX-eSOX17WHC
Plasmid#118839PurposeRetroviral expression of a mutant of Sox17 that improves efficiency of iPSC generationDepositorAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR06
Plasmid#69152Purposeread-outloxN mCherry to GFP switch for integration on ttTi5605, Mos Chr IIDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0 and codon-optimzed index…Promoterrps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_AIO-TetOn_mScarlet_Up-Tandem
Plasmid#229793PurposeBxb1-GA donor plasmid with upstream tandem syntax for all-in-one doxycycline-inducible mScarlet expressionDepositorInsertTRE-mScarlet; rtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterTRE and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-4
Plasmid#227668PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. SmR, easily curable via sucrose counterselection.DepositorInsertSmR
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC1484-luc2
Plasmid#227138PurposeBarcoded assay, MAPK sensor; barcode BC1484DepositorInsertEGR1 promoter driving barcode 1484 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC0136-luc2
Plasmid#227137PurposeBarcoded assay, MAPK sensor; barcode BC0136DepositorInsertEGR1 promoter driving barcode 0136 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4_EGR1p-BC0132-luc2
Plasmid#227136PurposeBarcoded assay, MAPK sensor; barcode BC0132DepositorInsertEGR1 promoter driving barcode 0132 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-IVT_ACC-msfGFP[r5M]_ACC-mEBFP2
Plasmid#221082PurposePlasmid for producing DNA Templates for in vitro transcription. Produces msfGFP[r5M] and mEBFP2 from IVT mRNA.DepositorInsertACC-msfGFP[r5M]_ACC-mEBFP2
UseSynthetic BiologyPromoterCMV, T7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABR Bcd-LEXY
Plasmid#182594PurposeDrosophila integration plasmid expressing Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDK616
Plasmid#134202PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD) mutantDepositorAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only