We narrowed to 7,721 results for: tet on
-
Plasmid#183092PurposeExpresses FnCas12a in Bacteroides and used for genome editingDepositorInsertFnCas12a, gRNA, Promoter, HAB, TetR,
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1TDPGH023Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZH509
Plasmid#102664PurposeTetracycline inducible expression of GFPmut2 using bicistronic autoregulation; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG108-K - AhpC-Glow
Plasmid#185135PurposeBacteroides - Escherichia coli shuttle vector with TetQ and Kanamycin selection markers BS2 is cloned under the Bacteroides thetaiotaomicron ahpC promoterDepositorInsertsGlow gene
Bacteroides thetaiotaomicron ahpC promoter
UsePg106ExpressionBacterialAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pYPQ132-tRNA2.0
Plasmid#158394PurposeGolden Gate entry vector to express the 2nd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pYPQ133-tRNA2.0
Plasmid#158395PurposeGolden Gate entry vector to express the 3rd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-tRNA2.0
Plasmid#158396PurposeGolden Gate entry vector to express the 4th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135-tRNA2.0
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDAI-SceI-SacB
Plasmid#113635PurposeBroad host range replicative plasmid expressing the I-SceI homing endonuclease and the counterselectable marker SacBDepositorInsertsacB
ExpressionBacterialMutationPlease see Depositor CommentsPromotersacB promoterAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B2.0
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC-crRNA-Km
Plasmid#158712PurposePlasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells and a non-targeting crRNADepositorInsertAcGFP (for crRNA cloning)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterTetOAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM3Dq-mCherry
Plasmid#166599PurposeEncodes Cre-dependent hM3Dq-mCherry under control of the TREDepositorInserthM3Dq-mCherry
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK02
Plasmid#105133PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only