We narrowed to 11,625 results for: AGA
-
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-5xQUAS::Δpes-10P::AI::gur-3G
Plasmid#232613PurposeExpression of 'GUR-3' on activation via 'QF+hGR' chimeric proteinDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::QF+hGR::SL2::tagBFP
Plasmid#232607PurposePan-neuronal expression of chimeric protein 'QF+hGR' and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorInsertQF+hGR
ExpressionWormMutationN/AAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::gur-3G
Plasmid#232605PurposePan-neuronal expression of 'GUR-3' using a genomic fragment, regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-5xQUAS::Δpes-10P::AI::prdx-2G
Plasmid#232614PurposeExpression of 'PRDX-2' on activation via 'QF+hGR' chimeric proteinDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G
Plasmid#232606PurposePan-neuronal expression of 'LITE-1' using a genomic fragment, regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PtetA with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225644PurposetetA promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA
TagsmCherryExpressionBacterialPromotertetA promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLac0301 with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225643PurposeLac0301 promoter expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInsertLacO3O1
TagsmCherryExpressionBacterialPromoterLacO3O1 promoterAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only