We narrowed to 645 results for: SH3
-
Plasmid#82245PurposeGateway Donor vector containing SOCS3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-BIN1_tv8
Plasmid#126574PurposeMultisite gateway middle entry vector containing human BIN1 transcriptional variant 8 (muscle specific) with no ATG. Parton lab clone DVA.DepositorInsertBIN1 (BIN1 Human)
UseGateway CloningAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ASCL3
Plasmid#101515PurposeDonor Vector containing ASCL3 transcription factor, part of the Human TFome CollectionDepositorInsertASCL3 (ASCL3 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCSB-Broad Human Kinase ORF Collection
Plasmid Kit#1000000014PurposePlasmids for over 500 human kinases and kinase-related proteins in Gateway entry vectors.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only