170,909 results
-
Plasmid#85044PurposeMammalian expression of mScarlet-iDepositorHas ServiceCloning Grade DNAInsertmScarlet-i
ExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EphA2-YFP
Plasmid#108852PurposeEncodes for human EphA2 fluorescently labeled with eYFP on the C-Terminus via a 15 amino acid (GGS)5 flexible linkerDepositorInsertEPHA2 (EPHA2 Human)
TagsLabeled with eYFP on the C-Terminus via a 15 amin…ExpressionMammalianAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MTK3_038
Plasmid#123752PurposeEncodes R-Flinc-A, a cAMP reporter, as a Type 3 part to be used in the MTK systemDepositorInsertR-FlincA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pminiTol2
Plasmid#31829DepositorTypeEmpty backboneUseCloning vectorAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DAAO
Plasmid#60344PurposeYeast D-Amino acid oxidase from Rhodotorula gracilis, optimized for mammalian expression.DepositorInsertDAAO
ExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac2.0
Plasmid#119872PurposeCumate-inducible expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR
sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPveg promoter with CuO sequence and PxylR promoterAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Src-Y530F
Plasmid#124659PurposeHuman c-Src with Y530F mutationDepositorAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1_TREtight-GEM2-Halo-FRB-IRES-FKBP-SNAP-GFPNb_EF1a-rtTA3-T2A-Puro-P2A-Thy1.1
Plasmid#197061PurposeDonor plasmid for human AAVS1 locus knock-in, doxycycline-inducible expression of GEM2-Halo-FRB and Adaptor Protein (FKBP-SNAP-vhhGFP4)DepositorInsertsEncapsulin
Adaptor Protein
UseCRISPRTagsFRB and HaloTagExpressionMammalianMutationCodon-optimised for human cell expressionAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCH45 (multiAsCas12a-KRAB lenti)
Plasmid#217330PurposeLentiviral expression of multiAsCas12a-KRABDepositorInsertmultiAsCas12a
UseCRISPR and LentiviralTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2MutationR1226A/E174R/S542R/K548RPromoterUCOE-SFFVAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19_HDRT_TRAC_CD19-CAR
Plasmid#183473PurposeEncodes for a homology-directed DNA repair template for the insertion of a second generation CD19-specific CAR into the TRAC geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYSEAP
Plasmid#37326DepositorInsertSEAP
ExpressionMammalianPromoterEF1aAvailable SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHel2
Plasmid#102960PurposeE.coli/H.Pylori shuttle vectorDepositorTypeEmpty backboneUsePlasmid shuttle vector system for genetic complem…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA (AAV1)
Viral Prep#65453-AAV1PurposeReady-to-use AAV1 particles produced from AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA (#65453). In addition to the viral particles, you will also receive purified AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA plasmid DNA. TRE-driven, Cre and Flp-dependent expression of EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromotertetOTagsEGFP (Cre and Flp-dependent)Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOpen-DpnIR
Plasmid#165529PurposeUsed to digest methylated DNA; to be expressed in dam- E. coli strains (strains which do not methylate their genomic DNA)DepositorInsertDpnI
UseSynthetic BiologyAvailable SinceAug. 5, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET30b-5M SrtA with TEV site
Plasmid#86962PurposeExpresses calcium-dependent Sortase A with a TEV cleavage site proximal to the C-terminal histidine tagDepositorInsertS.aureus SrtA 5M
Tags6x Histidine tag and TEV siteExpressionBacterialMutationP94R, D160N, D165A, K190E, K196TPromoterT7Available SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-P2A-GFP
Plasmid#188778PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNP3386 [For use in genome insertion and off-target assessment]
Plasmid#247258PurposeExample plasmid for bridge recombinase mediated insertion and off-target assessment with puromycin selection — must clone in UMIDepositorInsertISCro4 Recognition Site-UMI-Ef1a-PuroR-P2A-mCherry (Plasmid for Insertion Site Mapping [Example, Clone in Sequence + UMI])
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OT1.0
Plasmid#185386PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) sensor GRAB_OT1.0 in neuronsDepositorHas ServiceAAV1 and AAV9InsertGPCR activation based oxytocin sensor GRAB_OT1.0
UseAAVPromoterhSynAvailable SinceSept. 20, 2022AvailabilityAcademic Institutions and Nonprofits only