Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLC-RFP657-CASP8
(Plasmid #75164)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75164 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPRv1
  • Total vector size (bp) 11696
  • Modifications to backbone
    Swap puromycin resistance for tagBFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CASP8 sgRNA
  • Alt name
    Caspase-8
  • gRNA/shRNA sequence
    GCCTGGACTACATTCCGCAA
  • Species
    H. sapiens (human)
  • GenBank ID
    NG_007497.1
  • Entrez Gene
    CASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer AAACTTGCGGAATGTAGTCCAGGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLC-RFP657-CASP8 was a gift from Beat Bornhauser (Addgene plasmid # 75164 ; http://n2t.net/addgene:75164 ; RRID:Addgene_75164)
  • For your References section:

    Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. McComb S, Aguade-Gorgorio J, Harder L, Marovca B, Cario G, Eckert C, Schrappe M, Stanulla M, von Stackelberg A, Bourquin JP, Bornhauser BC. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. 10.1126/scitranslmed.aad2986 PubMed 27194728