We narrowed to 10,563 results for: ESP
-
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA p21 K161R, K163R
Plasmid#78789PurposeTo overexpress p21 K161R, K163R in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S449A/T450A/S454A
Plasmid#19845DepositorInsertMKL1 S449A/T450A/S454A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 449, Threonine 450 and Serine 454 …Available SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/BirA/FLAG-DDX54
Plasmid#97063PurposeExpresses BirA/FLAG-tagged DDX54 in mammalian cellsDepositorAvailable SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(92Q)-S776D
Plasmid#21757DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 92 Q(Glutamines) and…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX-6MYC p21
Plasmid#78780PurposeTo overexpress p21 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RNF8-Middle-part
Plasmid#64672PurposeExpresses only Middle part of RNF8, lacking N and C terminus, amino acids 112-401DepositorInsertring finger protein 8 (RNF8 Human)
TagsGFPExpressionMammalianMutationContaining only middle part of RNF8 amino acids 1…PromoterCMVAvailable SinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHS0537 CRISPR-associated IscB locus (Delaware Bay) in pBR322 with Fn spacer
Plasmid#176588PurposeEndogenous locus of CRISPR-associated IscB (Delaware Bay) with Fn spacerDepositorInsertCRISPR-associate IscB (Delaware Bay) locus
ExpressionBacterialMutationReplaced spacer in CRISPR array with Fn spacerAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG71 BDNF 3'UTR mut
Plasmid#12054DepositorInsertBDNF 3'UTR mut (BDNF Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1TCbt
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-HRV3C/D614G
Plasmid#164568PurposeSARS-CoV-2 Spike protein with furin site mutated to HRV3C site and D614G mutation (S-HRV3C-D614G variant)DepositorInsertSpike (S-HRV3C-D614G variant)
Tags2X Strep-Tag II and 8X His tagExpressionMammalianMutationD614GAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-L3F6H
Plasmid#177765PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
ExpressionMammalianAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3/hArf5(WT)-EGFP
Plasmid#79534PurposeExpresses C-terminally EGFP-tagged Arf5(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF WT
Plasmid#74384PurposeRetroviral expression vector containing Flag tagged WT MFF isoform 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776D
Plasmid#21755DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
GST-SF3B2 wild type aa 401-550 fragment
Plasmid#67615Purposebacterial expression of wild type GST-SF3B2 fragment (401-550)DepositorInsertsplicing factor 3b subunit 2 (SF3B2 Human)
TagsGSTExpressionBacterialMutationfragment of amino acids 401-550PromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only