We narrowed to 24,129 results for: c-myc
-
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-LEU2
Plasmid#157656PurposeGFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequenceDepositorInsertGFP-gRNA
UseInsert storage (replicative in e. coli)TagsGFP-gRNAAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGLTR-X-PURO
Plasmid#58246PurposeGATEWAY-compatible lentiviral conditional RNAi delivery vector; SFFV-driven expression of TetR and Puromycin selectionDepositorInsertPuro(R)
UseLentiviral and RNAi; Gateway destionation vectorTagsTetR-NLS-T2AExpressionMammalianPromoterSFFVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTJK512
Plasmid#121469PurposeCEN LEU2 CNB1DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK502
Plasmid#121457PurposeCEN HIS3 CNB1DepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK518
Plasmid#121475PurposeCEN TRP1 CNA1ΔAIDDepositorInsertCNA1deltaAID
UseYeast cen vectorMutationTruncated after amino acid 508PromoterEndogenous genomic promoter regionAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK519
Plasmid#121476PurposeCEN TRP1 CNA1ΔCBDDepositorInsertCNA1deltaCBD
UseYeast cen vectorMutationTruncated after amino acid 453PromoterEndogenous genomic promoter regionAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCytERM-mScarlet3-H (aka mYongHong)
Plasmid#239416PurposeExpresses CytERM-mScarlet3-H in mammalian cellsDepositorInsertCytERM
TagsmScarlet3-H (aka mYongHong)ExpressionMammalianMutationM163H in mScarlet3PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA repair library with 1,573 sgRNAs
Pooled Library#177663PurposeCRISPR-interference (CRISPRi) library of 1,573 sgRNAs targeting 476 genes encoding factors involved in DNA repair and associated processesDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Gattinara in pRDA_118 backbone
Pooled Library#136986PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brunello human genome-wide library.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Gouda in pRDA_118 backbone
Pooled Library#136987PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brie mouse genome-wide library.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA repair library with 336 sgRNAs
Pooled Library#177664PurposeCRISPR-interference (CRISPRi) library of 366 sgRNAs targeting 118 genes encoding factors involved in DNA repair and associated processesDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only