We narrowed to 21,204 results for: KIN
-
Plasmid#131812PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 35 and 36DepositorArticleInsertM. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 35 and 36
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW008
Plasmid#131809PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 30 and 31DepositorArticleInsertM. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 30 and 31
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW006
Plasmid#131807PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 25 and 26DepositorArticleInsertMastigocladus laminosus ferredoxin mutant with the estrogen recepor-ligand binding domain fused between amino acids 25 and 26
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF738
Plasmid#122032PurposeEF1a-WNV-protease-GFPDepositorInsertsUseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLacI-LAP
Plasmid#115902PurposeBackbone for expressing LacI-LAP-fused proteins.DepositorTypeEmpty backboneUseLentiviralTagsEGFPAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWW2149
Plasmid#80392PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains.DepositorInsertTaz Histidine Kinase
UseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK_proNR2_LGK.1
Plasmid#81161PurposeExpresses levoglucosan kinase variant LGK.1 with promoter proNR2DepositorInsertLevoglucosan kinase
TagsHis6xExpressionBacterialMutationLGK.1 (L140I,S142A,A373C)PromoterproNR2Available SinceSept. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK392
Plasmid#70236PurposeProtein production from a synthetic gene encoding Treponema denticola ATCC 35405 PurE-H40NDepositorInsertphosphoribosylaminoimidazole carboxylase
ExpressionBacterialMutationHis40AsnAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUASp YFP Rabx5 WT
Plasmid#53494DepositorInsertRabx5
TagsYFPExpressionInsectPromoterGAL4Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUASp YFP Rabx2 DN
Plasmid#53475DepositorInsertRabx2
TagsYFPExpressionInsectMutationS21NPromoterGAL4Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pKS100
Plasmid#24630DepositorInsertfadD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcAla12/Ala17
Plasmid#17682DepositorInsertc-src S12A S17A (SRC Chicken)
ExpressionMammalianMutationSer 12 changed to Ala. Ser 17 changed to Ala.Available SinceApril 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcA12/F527
Plasmid#17683DepositorInsertc-src S12A Y527F (SRC Chicken)
ExpressionMammalianMutationSer 12 changed to Ala. Tyr 527 changed to Phe .Available SinceApril 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pFredB-PTTG1
Plasmid#16585DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAM003
Plasmid#170007PurposeEncodes PmgtC-sfgfp reporter and TetR-controlled expression of S. Typhimurium PhoPDepositorArticleInsertsSuperfolder GFP
PhoP
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1 and PmgtCAvailabilityAcademic Institutions and Nonprofits only