We narrowed to 9,227 results for: sgRNA
-
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
Plasmid#222992PurposeMammalian expression of iNme2Cas9 construct with EGFP-targeting sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
UseCRISPRTagsPuroExpressionMammalianPromoterpCAGAvailable sinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
E.coli_GW-sgRNA_Lib4
Pooled library#113137PurposeGenome-wide gRNA library for E. coli, sub4DepositorExpressionBacterialAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
E.coli_GW-sgRNA_Lib1
Pooled library#113134PurposeGenome-wide gRNA library for E. coli, sub1DepositorExpressionBacterialAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS2602_AAV-Nme2-ABE8e-i1(V106W)-U6-2xSapI
Plasmid#201684PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1(V106W) and U6 sgRNA cassette. SapI enables cloning new spacers.DepositorInsertNme2-ABE8e-i1 (V106W)
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 PLIN2
Plasmid#202196PurposepX330 backbone expressing sgRNA to edit the C-terminus of human PLIN2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPLIN2 (PLIN2 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
epi-ABEmax
Plasmid#135974PurposeExpresses ABEmax, EBNA1 and blasticidin resistence gene; cloning backbone for sgRNA; Contains Epstein-Barr virus oriP replication originDepositorTypeEmpty backboneExpressionMammalianAvailable sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCRISPRi-v2, Gene Expression (m5), top 5 sgRNAs/gene
Pooled library#83993PurposeMouse CRISPRi Pooled Library targeting gene expressionDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
UMI-sgRNA-CH
Pooled library#234820PurposeUnique molecular identifiers-linked sgRNA library targeting chromatin factors (CH) in mice.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2M1
Plasmid#202758PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2M1DepositorInsertgRNA targeting AP2M1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only