We narrowed to 16,499 results for: grna
-
Plasmid#124211PurposegRNA/Cas9 expression for 2nd editing using pSLHDR04DepositorInsertgRNA
UseCRISPRAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato90/816
Plasmid#188487PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 90 & 816.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Tubb3 no donor
Plasmid#183431PurposeCreOFF gRNA expression for beta3-tubulin (amino acid position: stop codon)DepositorInsertgRNA
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLHDR_R1
Plasmid#124209PurposegRNA/Cas9 expression for 2nd editing using pSLHDR01, 02DepositorInsertgRNA
UseCRISPRAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJB172
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas28
Plasmid#82385PurposesgRNA targeting YFP expressed from pJ23108 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23108Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas27
Plasmid#82384PurposesgRNA targeting YFP expressed from pJ23117 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23117Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
OA-1045D
Plasmid#125006PurposeExpresses gRNAs targeting hedgehog and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-EEA-5g-OSK2M2L1-PGK-Puro
Plasmid#102909PurposePiggyBac transposon system construct for expression of 10 gRNAs targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters and 5 gRNAs targeting EEA-motif. Includes PGK-puro selection cassette.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Template ORF0
Plasmid#240304PurposeDonor:smFP-V5 KO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only