We narrowed to 11,552 results for: ANG
-
Plasmid#254055PurposeSuicide vector for allelic exchange with sucrose-based negative selection via sacB gene. Derived from pKNOCK-bla-ermGb and pCVD442.DepositorTypeEmpty backboneUseAllelic exchange in bacteroidesPromoterrpoD (for sacB)Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pX459-TMEM217-gRNA#1
Plasmid#249417PurposepX459-gRNA#1 targeting the 5′ coding region of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-TMEM217-gRNA#2
Plasmid#249418PurposepX459 plasmid containing gRNA#2 targeting the end of the coding exon of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-AAK1-Ser624Asp
Plasmid#238069PurposeExpression of GFP-AAK1 in mammalian cellsDepositorInsertAP2-associated protein kinase 1 (AAK1 Human)
TagsGFPExpressionMammalianMutationSerine 624 changed to aspartateAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-1
Plasmid#251692PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-2
Plasmid#251693PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
REKAR67
Plasmid#223261PurposeEKAREN4 modified to be a Red-FRET sensor using miRFP670nano3 and miRFP720 (in that order; AKA REKAR67)DepositorInsertREKAR-67
TagsmiRFP670nano3 and miRFP720ExpressionBacterial and MammalianMutationmiRFP670nano3 - EKAREN4 - miRFP720PromoterhEF-1aAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
REKAR76
Plasmid#223262PurposeEKAREN4 modified to be a Red-FRET sensor using miRFP720 and miRFP670nano3 (in that order; AKA REKAR76)DepositorInsertREKAR-76
TagsmiRFP670nano3 and miRFP720ExpressionBacterial and MammalianMutationmiRFP720 - EKAREN4 - miRFP670nano3PromoterhEF-1aAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(G75Q)-GFP
Plasmid#246837PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with G75Q mutationDepositorInsertArl13b (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationchanged G 75 to QAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AcrVA1_cpGR2(GGS5)-S103ΔELS
Plasmid#246050PurposeExpression of AcrVA1-cpGR2 hybrid in mammalian cells; insertion before S103 with deletion of surrounding amino acids ELS; enables chemogenetic control of MbCas12aDepositorInsertAcrVA1_cpGR2-S103ΔELS
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔELSAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(T35N)-GFP
Plasmid#246838PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with T35N mutationDepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14974 - pAAV-AiE1045m-SYFP2-P2A-3XFLAG-H2B-WPRE3-BGHpA
Plasmid#243015PurposeAiE1045m is an enhancer sequence designed to drive AAV-mediated transgene expression in specific populations of brain cells.DepositorInsertSYFP2-P2A-3XFLAG-H2B
UseAAVAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4192
Plasmid#215250PurposeTU for the expression of the CRY2(PHR) gene fused to the Etr binding domain under the P35S promoter and TNOS terminator in alpha1.DepositorInsertP35S:EtrBD:CRY2PHR:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB3471
Plasmid#215244PurposeCDS of HispS from N. nambi codon optimized for N.benthamiana. This gene is the first step of the bioluminiscente pathway.DepositorInsertHispS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG005
Plasmid#231309PurposeVector part for BEVA; BEVA2.0 Position 3 RSF1010 broad host range origin of replication with oriT, CmR.DepositorInsertBEVA2.0 Position 3 RSF1010 broad host range origin of replication with oriT, CmR.
ExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only