We narrowed to 11,552 results for: ANG
-
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4653
Plasmid#215267PurposeTU for the constitutive expression of the flippase (FLP) recombinase with a nopaline synthase (Nos) promoterDepositorInsertpNos:FLP:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4829
Plasmid#215275PurposeTU for the constitutive expression of the N. nambi NPGA gene under the P35S promoter and the TNOS terminatorDepositorInsertP35S:NPGA:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-TLCV2
Plasmid#196331Purposethe TLCV2 plasmid with Tol2 recombination sites for integrationDepositorInsertCas9-2A-eGFP
UseCRISPR; Fish expressionExpressionBacterial, Mammalian, and Y…PromoterTight TRE promoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3774
Plasmid#215247PurposeCDS of CPH from N. nambi codon optimized for N.benthamiana. This gene is the final step and recycling of the bioluminiscente pathwayDepositorInsertCPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4652
Plasmid#215266PurposeTU for the copper regulated expression of the flippase (FLP) recombinase.DepositorInsertCBS:miniDFR:FLP:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3474
Plasmid#215370PurposeCDS of CPH from N. nambi codon optimized for N.benthamiana. This gene is the final step and recycling of the bioluminiscente pathwayDepositorInsertCPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ121-mTCBE
Plasmid#218172PurposeExpress plastid monomeric TALE-linked CBE, composed of TALE, a catalytically impaired, full length DddA variant (E1347A), a human APOBEC3A variant (hA3A-Y130F), and UGIDepositorInsertTALE-Intron-hA3A-Y130F-DddA full (E1347A)-UGI
UsePlastid base editingExpressionPlantAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3473
Plasmid#215246PurposeCDS of Luz gene from N. nambi codon optimized for N.benthamiana. This gene generate the luminiscence of the bioluminiscente pathwayDepositorInsertLuz
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3472
Plasmid#215245PurposeCDS of H3H from N. nambi codon optimized for N.benthamiana. This gene is the second step of the bioluminiscente pathwayDepositorInsertH3H
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-GyrB_A467
Plasmid#216234PurposeS. aureus USA300 GyrB mutant A467 residue codon-optimized for E. coliDepositorInsertDNA gyrase
Tags6xHisExpressionBacterialMutationChanged alanine 467 to valinePromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-GyrB_T522
Plasmid#216235PurposeS. aureus USA300 GyrB mutant T522 residue codon-optimized for E. coliDepositorInsertDNA gyrase
Tags6xHisExpressionBacterialMutationChanged threonine 522 to isoleucinePromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_3ABC_C147R
Plasmid#212978PurposeEncodes EV-D68 MO/14/18947 3ABC with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 3ABC C147R
UseMammalian cell free protein expressionTagsHAMutationchanged Cysteine 147 in 3C to ArgininePromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_VP12A_N84T
Plasmid#212983PurposeEncodes EV-D68 MO/14/18947 VP12A with telaprevir resistance mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 VP12A N84T
UseMammalian cell free protein expressionTagsHAMutationchanged Asparagine 84 from 2A to ThreoninePromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p186-RV-CAG-dio-mScarlet-T2A-mVenus
Plasmid#204740PurposeConditional expression of target gene mVenus with fluorescent reporter mScarletDepositorInsertmVenus
UseRetroviralPromoterCAGAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGM2_sgRNA2
Plasmid#201617PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGM2 (PGM2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGM2_sgRNA1
Plasmid#201616PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGM2 (PGM2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-RPE_sgRNA2
Plasmid#201619PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertRPE (RPE Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only