We narrowed to 7,684 results for: ef1a
-
Plasmid#184945PurposeLentiviral delivery of recombinase landing padDepositorInsertEc03 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT303 Ec04 Lenti pEF-attB LSR GFP
Plasmid#184946PurposeLentiviral delivery of recombinase landing padDepositorInsertEc04 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT304 Ec07 Lenti pEF-attB LSR GFP
Plasmid#184947PurposeLentiviral delivery of recombinase landing padDepositorInsertEc07 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX209-neo-HA-Ub-T2A-Tet3G
Plasmid#202436PurposeBicistronic expression of HA-tagged Ubiquitin (HA-Ubiquitin) and Tet-On 3G transactivator (Tet3G)DepositorInsertUbiquitin
UseCRISPR and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_PP1-mCitrine
Plasmid#172472PurposeMammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.DepositorInsertprolactinSS-PP1-mCitrine (parapinopsina Zebrafish)
UseLentiviralTagsmCitrine and prolactin signal sequence (cleaved p…ExpressionMammalianPromoterEF1alphaAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-full-length-CHMP3-HA
Plasmid#154176Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGA1-EF1α-sfGFP150TAG-4xtRNA
Plasmid#251517PurposeExpression of sfGFP150TAG using the Methanomethylophilus alvus (Ma) PylRS/tRNA system for site-specific incorporation of noncanonical amino acids at TAG codons in HEK293 cellsDepositorInsertsfGFP150TAG
TagsHis6 and V5ExpressionMammalianMutation150 TAG (amino acid 150 mutated to stop codon)PromoterEF1alphaAvailable SinceMarch 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4866 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF1a in MGEV
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4207 TNFR2 NTEVp chain in PolyTX-mNeonGreen
Plasmid#244175PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, and NTEVp (75S) (TNFRSF1B Synthetic, Human)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
289aa Met133, 138, 186Ileu ELL2
Plasmid#127272PurposeExpresses 289aa human ELL2 with Met133, 138, 186IleuDepositorInsertELL2 w Met to ILeus stopped at XbaI (ELL2 Human)
ExpressionMammalianMutationMet133, 138, 186 Ileu, cut with XbaI blunt fillinPromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-siRNAresHAUS6_IRES_Blast
Plasmid#182887PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (siRNA resistant version)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianMutationsilet mutations in aa 197 - 203 to confer resista…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only