We narrowed to 18,818 results for: multi
-
Plasmid#250343PurposeExpressing human ATG13 (aa. 1-230)DepositorInsertATG13 (ATG13 Human)
TagsGFPExpressionMammalianMutationonly amino acids 1-230PromoterCAGAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV_nLightG2
Plasmid#221670PurposeExpresses nLightG2DepositorInsertnLightG2
ExpressionMammalianAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV_nLightR2
Plasmid#221671PurposeExpresses nLightR2DepositorInsertnLightR2
ExpressionMammalianAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dLbCas12a-EGFP-NLS-3xFlag
Plasmid#236364PurposeOverexpression of dLbCas12a in human cellsDepositorInsertdLbCas12a
UseCRISPR and LentiviralMutationWTAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)
Plasmid#231129PurposeExpresses mutant E. coli TrpRS from a weak glnS promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertE. coli tryptophanyl tRNA synthetase
ExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSGAb/pEvol-AbTrpRS(H14)
Plasmid#231133PurposeExpresses mutant A. baumannii TrpRS from an inducible lac promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertA. baumannii tryptophanyl tRNA synthetase
UseAcinetobacter baumannii expressionExpressionBacterialMutationT12A, V151G, V153CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DEST (JDW 471)
Plasmid#242573PurposeGateway destination vector with a CAGGS promoter in the backbone.DepositorTypeEmpty backboneUseGateway subcloningAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S/S85C/T119M
Plasmid#242712Purposebacterial expression of TTRDepositorAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S/S85C/V122I
Plasmid#238122Purposebacterial expression of TTRDepositorAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S/S85C/F87A
Plasmid#238120Purposebacterial expression of TTRDepositorAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S/S85C/V30M
Plasmid#238119Purposebacterial expression of human TTR mutantsDepositorAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-IRESv4-HaloTag-tdMCP
Plasmid#241137PurposeExpresses Anti-GCN4 scFv-sfGFP and HaloTag-tdMCP to track mature and nascent SunTag-tagged proteins and MS2 tagged mRNADepositorInsertsAnti-GCN4 scFv
tdMCP
TagsHaloTag and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xHSPA1B array
Plasmid#236378PurposeExpression of array of 48 crRNAs targeting HSPA1BDepositorInsert48xHSPA1B crRNA array (HSPA1B Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xNFIL3 array
Plasmid#236379PurposeExpression of array of 48 crRNAs targeting NFIL3DepositorInsert48xNFIL3 crRNA array (NFIL3 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only