-
Plasmid#101729PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…PromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgSp1
Plasmid#174907PurposeSecond generation sgRNA against Sp1DepositorInsertSpecificity Protein 1 (SP1 Human)
UseTagsExpressionMammalianMutationMissense mutation to mutate PAM sequencePromoterEFS-NSAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRTagsExpressionMutationPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p330 VQR
Plasmid#101730PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q, and T1337R mutations in Cas9)PromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
p458 VRER
Plasmid#101728PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…PromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterJ23117Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRTagsExpressionMutationPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRTagsExpressionMutationPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
px330 EQR
Plasmid#101733PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationEQR (D1135E, R1335Q, and T1337R mutations in Cas9)PromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSM160
Plasmid#105684PurposePlasmid containing an RFP dropout used to construct randomized PAM libraryDepositorInsertRFP Golden Gate dropout
UseTagsExpressionBacterialMutationPromoterBba_R0040 TetR PromoterAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV FLEX Synaptophysin GFP
Plasmid#137188PurposeCre-dependent expression of synaptophysin-GFPDepositorInsertSynaptophysin GFP (Syp Mouse)
UseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV eGFP hPGK BSD
Plasmid#188519PurposeBackbone for CRISPR activation (CRISPRa) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
hJAM-A pcDNA3.1
Plasmid#70073PurposeExpresses human junctional adhesion molecule-A in mammalian cellsDepositorInsertjunctional adhesion molecule-A (F11R Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS30: pTarget(PmcCAST)
Plasmid#168163PurposeTarget plasmid containing PmcPSP1 and attachment site for PmcCAST.DepositorInsertsPAM for PmcCAST + PmcPSP1
tRNA-Val
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-eA3AmaxNG-BlastR
Plasmid#152999PurposeC-to-T base editor, NG PAMDepositorInserteA3A-nSpCas9 NG-UGI-UGI
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
EFS eGFP hPGK BSD
Plasmid#188520PurposeBackbone for CRISPR interference (CRISPRi) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorInsertSt1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only