We narrowed to 28,993 results for: CAL;
-
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB67
Plasmid#226316PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with K to A CsoS2 MR1-6
ExpressionBacterialMutationK261A, K320A, K380A, K436A, K495A, K546APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB68
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
ExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
ExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
ExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKDC.118
Plasmid#227188PurposeT7 IPTG-driven Cas13aDepositorInsertLbuCas13a
ExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm8.1
Plasmid#210288PurposeEmpty backbone with zeocin resistance for high expression in mammalian cellsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOm2.0
Plasmid#210300PurposeEmpty backbone with ampicillin resistance for high expression in mammalian cells with an added 5'UTRDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only