We narrowed to 10,598 results for: gal
-
Plasmid#124090PurposeFGF6-V5 tagged expression vectorDepositorInsertFGF6 (FGF6 Human)
UseLentiviralTagsV5Mutation3 silent SNPs: (189) C>G, (366) T>C and (41…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX2-KS
Plasmid#237680PurposeFor overexpression of mEGFP-SS18-SSX2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-FUS-repair-tempate
Plasmid#237684PurposeFor knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-Thr1273Glu
Plasmid#218458PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Thr1273Glu substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Thr1273Glu substitution and an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialMutationThr1273Glu substitutionAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-His1271Lys
Plasmid#218456PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (His1271Lys substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying His1271Lys substitution and an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialMutationHis1271Lys substitutionAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-SARS-CoV-2-S-tail-Lys1269Ala-His1271Ala
Plasmid#218459PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Lys1269Ala and His1271Ala substitutions) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Lys1269 and His1271 substitutions and an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialMutationLys1269Ala and His1271Ala substitutionsAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
JO-pH720-SARS-CoV-2-S-tail-Cys1254Ala-Thr1273Glu
Plasmid#218454PurposeBacterial expression plasmid for the cytosolic tail of SARS-CoV-2 spike (with Cys1254Ala and Thr1273Glu substitutions) and an N-terminal eXact tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying an N-terminal eXact tag and Cys1254Ala and Thr1273Glu substitutions (S SARS-CoV-2)
TagseXactExpressionBacterialAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-Thr1273Asp
Plasmid#218457PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Thr1273Asp substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Thr1273Asp substitution and an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialMutationThr1273Asp substitutionAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-∆ex8
Plasmid#209050PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged TAF5 isoform lacking the alternative exon-8 (∆ex8)DepositorInsertTAF5 deltaexon-8
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-miniTurbo-TAF5-∆ex8
Plasmid#209052PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of miniTurbo fused to TAF5 isoform lacking the alternative exon-8 (∆ex8)DepositorInsertTAF5 deltaexon-8
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-FL_WobbleMut
Plasmid#209055PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged full length TAF5 isoform mutated to be resistant to TAF5 siRNADepositorInsertTAF5 full length
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-∆ex8_WobbleMut
Plasmid#209056PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged TAF5 isoform lacking the alternative exon-8 (∆ex8) mutated to be resistant to TAF5 siRNADepositorInsertTAF5 deltaexon-8
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only