We narrowed to 10,780 results for: SEC
-
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GMR11F02-Gal4 UAS-GFP
Plasmid#230907PurposeTissue-specific expression of GFP in wing and haltere imaginal discs.DepositorInsertGFP
ExpressionInsectPromoterGMR11F02Gal4-UASAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-9
Plasmid#228968PurposeFor bacterial expression of anti-GFP nanobody LaG94-9, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-10
Plasmid#228969PurposeFor bacterial expression of anti-GFP nanobody LaG94-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-10
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-12
Plasmid#228970PurposeFor bacterial expression of anti-GFP nanobody LaG94-12, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-3
Plasmid#228963PurposeFor bacterial expression of anti-GFP nanobody LaG94-3, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-8
Plasmid#228967PurposeFor bacterial expression of anti-GFP nanobody LaG94-8, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-6
Plasmid#228966PurposeFor bacterial expression of anti-GFP nanobody LaG94-6, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-6
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-18
Plasmid#228972PurposeFor bacterial expression of anti-GFP nanobody LaG94-18, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-18
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-2
Plasmid#228975PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-4
Plasmid#228998PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-4, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-2
Plasmid#228962PurposeFor bacterial expression of anti-GFP nanobody LaG94-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-1
Plasmid#228961PurposeFor bacterial expression of anti-GFP nanobody LaG94-1, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-1
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-9
Plasmid#228993PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-9, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-8
Plasmid#228992PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-8, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only