We narrowed to 9,843 results for: CAG
-
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL655
Plasmid#231165PurposeT-DNA encoding gRNA targeting SlPDSDepositorInsertgRNA targeting SlPDS
ExpressionPlantPromoterAtU6Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
p2702-AGER-gRNA1
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiBIRC6-1
Plasmid#202447PurposeExpression of a CRISPRi guide targeting BIRC6DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgBIRC6-4
Plasmid#202438PurposeExpression of a guide RNA targeting BIRC6DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgBIRC6-5
Plasmid#202439PurposeExpression of a guide RNA targeting BIRC6DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1242-1709_H
Plasmid#146508PurposeMammalian Expression of HsTNRC6A_1242-1709DepositorInsertHsTNRC6A_1242-1709 (TNRC6A Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgGPAA1 guide 1
Plasmid#193608PurposeGPAA1 knockoutDepositorInsertsgGPAA1 guide 1 (GPAA1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#1/Cre
Plasmid#193239PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMroh2b#2/Cre
Plasmid#193220PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Mroh2b geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol11a1#1/Cre
Plasmid#193205PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col11a1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol11a1#2/Cre
Plasmid#193206PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col11a1 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
