We narrowed to 23,934 results for: CRISPR
-
Plasmid#192231Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-2 lentiCRISPR v2 plasmid
Plasmid#192228Purposelentiviral vector expressing sgRNA-2 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-2 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-1 lentiCRISPR v2 plasmid
Plasmid#192227Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRi
Plasmid#134989PurposedCas9-mediated inactivation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFS_0362_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._BA-91_ARRAY_1
Plasmid#116974PurposeExpresses CaBA-91RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. BA-91 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0356_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1_RC
Plasmid#116968PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0355_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1
Plasmid#116967PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast (Lentiviral Prep)
Viral Prep#61425-LVPurposeReady-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.DepositorPromoterEF1aAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCAS9-VP64_GFP (Concentrated Lentiviral Prep)
Viral Prep#61422-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.DepositorPromoterEF1aAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-CRISPRoffv2.1-IRES-BlastR
Plasmid#207180PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by EF1a PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorInsertP2A-clover-BlastR
UseCRISPRAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSB-TRE-CRISPRoff-EF1A-TetOn
Plasmid#203355PurposeDrug-inducible expression of CRISPRoff components needed for DNA methylation and gene repression with Sleeping Beauty backboneDepositorInsertCRISPRoff-TetOn
Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFVp-CRISPRoffv2.1-IRES-BlastR
Plasmid#207181PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by SFFV PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterSFFVpAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Px330-EGFP-LRRK2-CRISPR/Cas9
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgCasp8_#2-puro
Plasmid#231978PurposeKnockout mouse Casp8DepositorInsertsgRNA with Cas9 with puromycin resistance (Casp8 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgCasp8_#1-puro
Plasmid#231977PurposeKnockout mouse Casp8DepositorInsertsgRNA with Cas9 with puromycin resistance (Casp8 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only