We narrowed to 18,871 results for: cat.1
-
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-mB2M
Plasmid#154091PurposeSelf-Cutting and Integrating CRISPR backbone targeting murine B2MDepositorInsertsgRNA and BAIT targeting murine B2M locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK Smad2 deltaC Flag
Plasmid#12624DepositorInsertSmad2 deltaC (SMAD2 Human)
TagsflagExpressionMammalianMutationC-terminal truncated Smad2 (aa 1-424)Available SinceOct. 10, 2006AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5xE-Box
Plasmid#118052PurposeGBPart - Operator/DNA Response element - 5 copies of the E-box motifDepositorInsert5 copies of the E-box motif
UseSynthetic Biology; Domestication of dna parts for…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE
Plasmid#129704PurposeExpress HA-KASH for nuclei labeling and purificationDepositorInsertHA-VHH-KASH
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterEF1aAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSico-shRheb
Plasmid#81087Purposeconditional expression of an shRNA targeting murine RhebDepositorAvailable SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
ninaE-dsocs
Plasmid#26857DepositorInsertSlow Termination of Phototransduction (stops Fly)
TagsmycExpressionInsectMutationThis STOPS construct contains a mutated/truncated…Available SinceApril 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIBA2-SpyTag-MBP
Plasmid#107422PurposeControl construct for SpyCatcher experiments. Encodes MBP with N-terminal SpyTag, including OmpA signal peptide for periplasmic targeting.DepositorInsertMaltose-binding protein (MalE)
TagsOmpA signal peptide, SpyTag, and StrepIIExpressionBacterialPromoterTetAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS mPax2 (CT#670)
Plasmid#13960DepositorInsertPax2 (Pax2 Mouse)
ExpressionBacterialMutationThis is not full lenght Pax2. There is a 100 nunc…Available SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1-EGFP
Plasmid#112857Purposeplasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion proteinDepositorInsertapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1 Rat)
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX-MAPKAP1Del-FHH-IRES-Puro
Plasmid#120706PurposeExpresses MAPKAP1 Truncation-Flag-HA-6xHIS fusion protein in mammalian cells & for virus productionDepositorInsertMAPKAP1 Isoform 1
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationDeleted amino acids 193-522PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZA16
Plasmid#158494PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 D481V/L17E without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, D481V, no STOP codonAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCVneo-DEST
Plasmid#119746PurposeAllows Gateway cloning of gene of interest into retroviral pMSCV vector (with Neomycin/G418 resistance)DepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3B(E697A)
Plasmid#71214PurposedCas9 fused to BFP and the human DNMT3B catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3B(E697A), DNMT3B catalytic domain with inactivation mutation E697A
TagsdSpCas9-BFP-DNMT3B(E697A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-DNMT3B(E697A)-2A-Blast
Plasmid#71219PurposedCas9 fused to the human DNMT3B catalytically inactive domainDepositorInsertdSpCas9-DNMT3B(E697A), DNMT3B catalytic domain with inactivation mutation E697A
UseLentiviralTagsdSpCas9-DNMT3B(E697A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpySwitch
Plasmid#184225PurposeExpresses SpySwitch in the bacterial cytoplasm. SpySwitch binds SpyTag-, SpyTag002- or SpyTag003-fusions non-covalently for affinity purification, allowing gentle pH or temperature release.DepositorInsertSpySwitch
TagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria1
Plasmid#124853PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only