We narrowed to 10,780 results for: SEC
-
Plasmid#69887PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorExpressionInsectMutationF169L in ZKSCAN1PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pBacPak-HA-Non-stop
Plasmid#52289PurposeExpresses Drosophila Non-stopDepositorAvailable SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
20XUAS IVS Jaws mVenus_tr
Plasmid#111552PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mVenusDepositorInsertJaws_mVenus_tr
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiex PKC - Peptide 14 mCit mCer
Plasmid#83565PurposeExpresses a mCitrine-mCerulean FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the pseudosubstrate of PKCalpha.DepositorInsertPKC alpha (PRKCA Human)
Tags10 nm ER/K Helix, FLAG Purificaiton Tag, Tev Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-hDcr-K70A.
Plasmid#89145PurposeExpression of helicase mutant of human Dicer in Sf9 cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIMCyp (owl monkey)(K283D, Q287D)
Plasmid#79036PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5Cyp (owl monkey) (K283D, Q287D)
TagsOneSTrEP-FLAGExpressionInsectMutationChanged Lys 283 to Asp and Gln 287 to AspPromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-ZKSCAN1 548-1047
Plasmid#69886PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKG01701_CMV-rtTA-betaglobin_pA-CMV-PuroR-bGH
Plasmid#252540PurposeSecondary PiggyBac vector for puromycin selection and expression of transcriptional activatorDepositorInsertrtTA
ExpressionMammalianPromoterCMV (human cytomegalovirus immediate early enhanc…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2147 - pAAV nEF ConFon hChR2(H134R)-mCherry
Plasmid#202545PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1/CALR ins5-His
Plasmid#214796PurposeBaculovirus expression of human CALR ins5DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-SNAP25B-WT
Plasmid#248121PurposeMammalian expression lentiviral vector encoding the wild-type Synaptosomal-Associated Protein (SNAP-25)DepositorAvailable SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2294
Plasmid#228352PurposeMethanol-inducible ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterKpAOX1 promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only